Assignment 2: NCBI

 1. Pirin: Pirin

This family consists of Pirin proteins from both eukaryotes and prokaryotes. The function of Pirin i...

Accession: pfam02678 ID: 396999

 

2. cupin_RmlC-like: RmlC-like cupin superfamily

This superfamily contains proteins similar to the RmlC (dTDP (deoxythymidine diphosphates)-4-dehydro...

Accession: cl40423 ID: 424065

 

3. cupin_Yhhw_C: Escherichia coli YhhW and YhaK and related proteins, pirin-like bicupin, C-terminal cupin domain

This family includes the C-terminal domain of YhhW and YhaK, Escherichia coli pirin-like proteins wi...

Accession: cd20311 ID: 380445

 

4. cupin_pirin-like_C: pirin-like, C-terminal cupin domain

This family contains the C-terminal cupin domain of pirin and pirin-like proteins, including Escheri...

Accession: cd20288 ID: 380422

 

5. cupin_pirin-like_N: pirin-like, N-terminal cupin domain

This family contains the N-terminal cupin domain of pirin and pirin-like proteins, including Escheri...

Accession: cd20287 ID: 380421

 

6. cupin_Yhhw_N: Escherichia coli YhhW and YhaK and related proteins, pirin-like bicupin, N-terminal cupin domain

This family includes the N-terminal cupin domains of YhhW and YhaK, Escherichia coli pirin-like prot...

Accession: cd02910 ID: 380375

 

7. cupin_pirin_N: pirin, N-terminal cupin domain

This family contains the N-terminal domain of pirin, a nuclear protein that is highly conserved amon...

Accession: cd02909 ID: 380374

 

8. cupin_pirin_C: pirin, C-terminal cupin domain

This family contains the C-terminal domain of pirin, a nuclear protein that is highly conserved amon...

Accession: cd02247 ID: 380373

 

9. Pirin_C: Pirin C-terminal cupin domain

This region is found the C-terminal half of the Pirin protein.

Accession: pfam05726 ID: 399031

 

10. YhaK: Redox-sensitive bicupin YhaK, pirin superfamily [General function prediction only]

 

Accession: COG1741 ID: 224655

LOCUS       NG_012795

ACCESSION   NG_012795

VERSION     NG_012795.1

COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The

            reference sequence was derived from AC010853.11.

            This sequence is a reference standard in the RefSeqGene project.

           

            Summary: This gene encodes a large protein that resides in the

            limiting membrane of endosomes and lysosomes and mediates

            intracellular cholesterol trafficking via binding of cholesterol to

            its N-terminal domain. It is predicted to have a cytoplasmic

            C-terminus, 13 transmembrane domains, and 3 large loops in the

            lumen of the endosome - the last loop being at the N-terminus. This

            protein transports low-density lipoproteins to late

            endosomal/lysosomal compartments where they are hydrolized and

            released as free cholesterol. Defects in this gene cause

            Niemann-Pick type C disease, a rare autosomal recessive

            neurodegenerative disorder characterized by over accumulation of

            cholesterol and glycosphingolipids in late endosomal/lysosomal

            compartments.[provided by RefSeq, Aug 2009].

Question: Are there any results in a species other than Homo sapiens that has a

low E-value, high percent identity, and high percentage of query cover?

No.

Primer pair 1

Sequence (5'->3')             Template strand               Length  Start      Stop       Tm          GC%      Self complementarity     Self 3' complementarity

Forward primer CAATGGCCTCAGACGTCACTA      Plus        21           424         444         59.80     52.38     6.00        3.00

Reverse primer TGCTGCTGATCTGCAACCTT          Minus   20           624         605         60.25     50.00     8.00        2.00

Product length  201

Primer pair 2

Sequence (5'->3')             Template strand               Length  Start      Stop       Tm          GC%      Self complementarity     Self 3' complementarity

Forward primer TGGCCTCAGACGTCACTAAAT      Plus        21           427         447         59.10     47.62     6.00        2.00

Reverse primer TGCTGCTGATCTGCAACCTTC       Minus   21           624         604         61.22     52.38     8.00        0.00

Product length  198